Instructions to use RaphaelMourad/Mistral-DNA-v1-138M-bacteria with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use RaphaelMourad/Mistral-DNA-v1-138M-bacteria with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("text-generation", model="RaphaelMourad/Mistral-DNA-v1-138M-bacteria")# Load model directly from transformers import AutoTokenizer, AutoModelForCausalLM tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-bacteria") model = AutoModelForCausalLM.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-bacteria", device_map="auto") - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use RaphaelMourad/Mistral-DNA-v1-138M-bacteria with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "RaphaelMourad/Mistral-DNA-v1-138M-bacteria" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "RaphaelMourad/Mistral-DNA-v1-138M-bacteria", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker
docker model run hf.co/RaphaelMourad/Mistral-DNA-v1-138M-bacteria
- SGLang
How to use RaphaelMourad/Mistral-DNA-v1-138M-bacteria with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "RaphaelMourad/Mistral-DNA-v1-138M-bacteria" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "RaphaelMourad/Mistral-DNA-v1-138M-bacteria", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "RaphaelMourad/Mistral-DNA-v1-138M-bacteria" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "RaphaelMourad/Mistral-DNA-v1-138M-bacteria", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }' - Docker Model Runner
How to use RaphaelMourad/Mistral-DNA-v1-138M-bacteria with Docker Model Runner:
docker model run hf.co/RaphaelMourad/Mistral-DNA-v1-138M-bacteria
Model Card for Mistral-DNA-v1-138M-bacteria (mistral for DNA)
The Mistral-DNA-v1-138M-bacteria Large Language Model (LLM) is a pretrained generative DNA text model with 17.31M parameters x 8 experts = 138.5M parameters. It is derived from Mistral-7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced. The model was pretrained using around 700 bacterial genomes with 10kb DNA sequences.
For full details of this model please read our github repo.
Model Architecture
Like Mistral-7B-v0.1, it is a transformer model, with the following architecture choices:
- Grouped-Query Attention
- Sliding-Window Attention
- Byte-fallback BPE tokenizer
Load the model from huggingface:
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-bacteria", trust_remote_code=True) # Same as DNABERT2
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-bacteria", trust_remote_code=True)
Calculate the embedding of a DNA sequence
dna = "TGATGATTGGCGCGGCTAGGATCGGCT"
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 256]
# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 256
Troubleshooting
Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.
Notice
Mistral-DNA-v1-138M-bacteria is a pretrained base model for DNA.
Contact
Raphaël Mourad. raphael.mourad@univ-tlse3.fr
- Downloads last month
- 99